i'm reluctantly facing the possibility that the brickhouse gazette is not an online journal, (personal reflections put up to start a dialogue with others) but rather a newspaper than nobody reads (pretentious in style and pathetic in existence). i don't want to change who i am. can i change my writing style without compromising myself?
 

i'd like to be a better citizen. i'd love to kick bush out of the white house. these two reasons are why i've started attending "meetups." meetup is "a free service that organizes local gatherings about anything, anywhere."

of particular interest to me are the meetups for presidential candidates. according to the "top topics in usa presidential" list on meetup's usa presidential candidate site, meetups for a nonexistent campaign, gore in 2004, have better attendance than meetups for bush in 2004. not that this reflects the true quantity of bush supporters, but it shows they don't use this convenient, grassroots method of mobilizing. i'd say it was a shame, but i'd be lying.

if you want to fulfill a civic duty, or you're just fed up with the status quo, combining your small effort with a few other people adds up to a large effort. meetups are one easy way to connect with those other people.

if you want to know more about a candidate, attending (or starting!) a meetup is a great way to find out why other people in your area support him or her.

you don't need to have your mind made up to get involved. i signed up to attend meetups for one candidate, decided he wasn't for me, and have since been attending meetings to support howard dean.

 

the new york times has an interesting article about new "voice fonts":

These fonts are made up of a database of phonemes, the basic sounds that make up any language. To create the database, technicians record a singer performing as many as 60 pages of scripted articulations (like "epp, pep, lep"). Assorted pitches and techniques like glissandos and legatos are also thrown in the mix; with all the combinations, the process takes a week of five-hour singing days.

i'd really love to hook this, or something like it, up to my computer-generated poetry page (which also uses a database of phonemes) to produce computer-generated music. it doesn't look likely i'll be able to do something like this any time soon, but maybe some day.

 

ann maria bell stopped by here last week, and did a good job of obscuring the more obvious similarities between [her] mental state and a bowl of pudding. i'm not sure i achieved the same. i think i was under the influence of too much insulin at the time, though i can't be sure because i can no longer afford to take proper care of my diabetes (which is not to say i always did before, but at least it was my choice then). but that was only part of the problem. the other part was that i'm an introvert, and as soon as ann walked in the door i realized that my online personae doesn't convey this at all. online all i do is communicate, but in the physical world i do relatively little of that. ann, on the other hand, is just as communicative and interesting in person. perhaps i'll deal differently with the problem of reconciling my online and offline identities next time it comes up. i just hope it comes up again.

 

my noun page is a PHP implementation of mark pilgrim's universal noun pluralizer. if you run one of the 600,000 sites that boast of "1 comments", you should use this code.

 

i did robots.txt handling for the job search over at dismployed (which, by the way, is now the most user-friendly and useful job search on the internet, in my biased opinion) by extending the open source "snoopy" php class. i thought this might be useful for others, so i tried to come up with a less complicated demonstration here on randomchaos. what i came up with turned out to be more complicated than i expected, and it's almost certainly missing something, but i nonetheless point you to browser spoof.

if it isn't obvious from the name, the tool lets you pass as other browsers (or more broadly, user agents). it will hopefully be useful for those sites that do browser sniffing and prevent access to certain browsers (among other uses). it will also stop you from accessing a page if the user agent you're passing as is disallowed in the requested server's robots.txt file. to do this, it uses the new robots.inc class, which was designed for exactly this purpose, in the interest of having a standards-friendly search engine over at disemployed.

 

on the boston globe:

Using a database of over 100,000 brief segments of speech, they noted which frequency had the greatest emphasis in each sound. The resulting set of frequencies, they discovered, corresponded closely to the chromatic scale. In short, the building blocks of music are to be found in speech.

why is that assumed over the alternative conclusion, that the building blocks of speech are to be found in music? either way, interesting stuff.

 

i imagine at some point we will have applications (or operating systems) that do the work of subscriptions for other applications. we will subscribe to addresses, and individually assign each subscription an interval to wait between reloads. when new content arrives, it will be automatically sent out to applications that can handle it. new events will be sent to our calendars, new music will be sent to our music applications, new photos will be sent to our photo applications, and new web content will be sent to applications that will look a lot like modern news readers, only without the subscriptions. the usefulness of subscriptions is general enough that i already have multiple unrelated applications using it. these applications would be easier to develop if the work of subscriptions was already done, which would result in better software for users.

 

i'm generally skeptical of much of what's newly available for diabetic treatment, such as implants and vaccines. but the bbc today reported the first news that excited me in this area: a possible cure for diabetes.

 

shelley powers writes about what she calls a "gender ghetto":

The power of weblogs is that anyone can have one and post their thoughts online. There is a true democracy at work. However, a democracy isn't always the best form of group organization within a heterogeneous body. What happens is that the majority tends to hold all the influence.

Supposedly within weblogging, women form over 50% of the webloggers, and you would think that they then receive 50% of the links. However, what I'm finding, at least in the weblog circle that I tend to traverse on my daily prowls, is that links to women occur much less frequently than links to men. I'm not talking blogroll links; I'm talking about links to posts, with associated commentary.

shelley's assumption that the top echelons of weblogging would be come close to representing the broader population stems from a confusion between the majority holding all the influence, and exercising it. the parable of mouseland seems appropriate:

All the laws were good laws. For cats. But, oh, they were hard on the mice. And life was getting harder and harder. And when the mice couldn't put up with it any more, they decided that something had to be done about it. So they went en masse to the polls. They voted the black cats out. They put in the white cats.

shelley seems to be advocating voting for white cats without questioning why the mice are voting for cats at all. why everyone fills their weblogs with links to the same few people is, i think, a more interesting question than why these few people are men. (the answer to that question is simple: they're men because weblogging came from the real world, in which men have long enjoyed priviledge over women.) the gender gap shelley has described is nothing more than one aspect of the power law clay shirky described. if women were at the top of the power curve, most links would be to women. women get disproportionately less links in the current system, but so does anyone who is in some way unlike those at the top of the power curve. the top will never be representative of the bottom because it can't be. the power curve is a power curve because the top is significantly different than the bottom. if it weren't, the curve would be flatter, but it's not. shelley's "gender ghetto" is in no way segregated from the rest of the bottom of this curve, so the real "ghetto" is the whole bottom of the curve, which contains about 99% of all webloggers. it's not much of a "ghetto".

gender doesn't strike me as an interesting distinction here, partly because i don't believe you can reliably tell someone's gender from their writing. the gender genie found that i often write "like a female", and jessica often writes "like a male". shelley concludes her piece with I want to be an influence now, but she is an influence now. she's just not a power now. she's not one of the few people whose links are copied on thousands of other weblogs. but does she really want to be? if we're only concerned with concentrating the power in new hands at the top of the power curve, we're missing out on the bigger opportunity to flatten the curve by finding ways to turn our influence into networked power at the bottom. because while the power may rest at the top of the power curve right now, the potential power is undoubtedly largest at the bottom. we all use our influence (linking) to increase the concentration of power at the top by turning over our influence to them (if they link to something, we do too), but how could we be using it to create power at the bottom, where it could be much greater? i think this is a much larger and more important question than shelley's Women's voices have not not been heard as loudly as they should in these areas in the past -- is this same lack of influence now going to be taken into the communication media of the future? but if that's a good catalyst to get people interested in the issues of how we could better use our influence, it couldn't hurt. i'd just like to see the issue expanded a bit to include the other 49% of us down here at the bottom of the power curve.

 

i've been wanting to put into clearer words my reasoning for ending my support for kucinich, because i've found that i'm actually anti-kucinich now. i haven't talked about this with any of the few people i know who still support him, because i didn't really have an argument against him. it was just my own bad experiences, and a vague feeling i had this these experiences were a reflection of the campaign. i just found an argument that puts my feelings in better words than i could:

If running for the presidency was a left-wing essay contest, then we would all vote for Kucinich. It isn't. Presumably Kucinich has heard of the Internet. Where was his Internet campaign? Where, indeed, is the Kucinich organization at all? Does Kucinich believe that there is some invisible, natural majority for his ideas that will simply appear like genies when he says his magic words? Kucinich is running a vanity campaign, pure and simple.

that's precisely what i feel it is too: a vanity campaign. what bothers me so much is that it's at the expense of people who are spending their time and energy supporting him. it's one thing for him to talk about peace, but the kucinich campaign was in practice by far the worst internal bickering i've ever experienced, and i saw no sign (and have still seen no sign) that anyone at the national campaign cared. so i'm anti-kucinich. i not only no longer support his campaign; i oppose it.

 

shelley powers writes about health insurance as the new class system in america:

Now you can have no health insurance and you'll either be the working poor, or you'll be rich enough not to need it. Being completely poor, and I mean on the street homeless, you'll not need it either because you use the emergency rooms for all your medical needs.

i hadn't previously thought of myself and part of the working poor class. and i'm not even working regularly (for pay, anyway), so i guess that makes me just poor. but i'm at least enough a part of the middle class to have savings, which i can rely on for a few more months hopefully before i'll need to give up and go abroad again.

my previous two trips abroad were mostly adventures. the first was to japan during university. then after university, i went to teach english in taiwan. that was slightly less for my own enjoyment and enlightenment, as i was certainly conscious of how the salary would help me quickly pay off my school loans. but it increasingly appears that my next trip to asia will be primarily influenced by my need for healthcare. being diabetic, i simply can't find affordable healthcare in america. and by "affordable", i mean less than what i'm paying in rent.

if i have to leave my country because i can't afford health insurance here, i won't be coming back until i can. i'm not so arrogant as to think i alone am a significant loss for the country, but i think i'm a symptom of a larger problem. i graduated with honors from a pretty good university. i was a good student. i'm a smart guy and a good worker. and i can't find affordable health insurance in america. this must be having a tremendous negative impact not only on my fellow uninsured americans, but also on the country as a whole, as we lose too many good citizens to countries with better health care systems.

 

thanks to boingboing, i have my valentine for next year written already:

you activate my dopamine-rich brain regions and parts of my anterior cingulate cortex.
 

a post on boingboing talks about how lists of shows to watch on tivo become "to-do" lists:

When I first got my TiVo, having a lot of programming on the drive felt like someone had done me a large favor; but over time, it felt almost like a nag: here's all this "work" I've got piled up for you to do.

i have this problem with both my email and my news reader. i have real work to do this morning, but i can't bring myself to leave the 47 unread items sitting there. and there's no way to make the new item notification go away. i've just shrunk it down as far as i can, and i'll do my best to remember that it's not really a to-do list; it just looks like one.

 

the wiktionary is the dictionary form of the wikipedia. both are collaborative open content projects. i regularly use the wikipedia, and the wiktionary is promising, but just short of its potentional currently.

one thing missing from the wiktionary now is the important function of a dictionary in maintaining a complete set of known words. a dictionary not only provides definitions for existing words, but also provides a definitive list of which combinations of characters are words and which are not. if i search dictionary.com for a string of letters and no entries are found, i have a fairly good indication that string of letters isn't a word. but if i search wiktionary.org for the same string of letters and nothing comes up, i don't know if that's because it's not a word, or because no one has yet entered it. and of course the same problem exists with found words, as there's nothing stopping someone from entering definitions for words that don't exist. this incompleteness will likely be an ongoing problem for the wiktionary unless a conscious effort is made to fill in all the gaps.

making the wiktionary comprehensive isn't necessary to make it incredibly useful. it already does a great job of cross referencing words of different languages, making it a promising (though again, not complete) translation aid. also, if the wiktionary implemented some wiki markup specific to its task, such as standard means of marking things like synonyms, antonyms, other grammatical forms of the same root word, pronunciation, and so on, the wikipedia could be used as a huge data source for computational linguistics applications.

computational linguistics requires both a lexicon and a grammar, and the wiktionary could provide the first half with some minor tweeking. i had previously considered implementing the second half in some sort of distributed system wherein one site would define a sentence as (amount other things) a noun phrase followed by a verb phrase, and then point to other sites which would define what makes up noun phrases and verb phrases. it occurs to me now that this could all be stored in a central wiki, and cross-referenced with the wiktionary.

in other news of wiki applications, see wikiquote, which makes me question whether there is any further need for QML. again, what is needed is standardization of format so that the data in this wiki can be reused and reformated. as it is, it's just a bunch of text.

 

reading jonathon delacour's revelation that he's "conservative" makes it clear to me that the old left-right axis is almost entirely useless. i generally consider myself "liberal", but i generally agree with jonathon's opinions, as expressed in his weblog. so either i'm not really "liberal", or he's not really "conservative", or those words aren't really important. i strongly suspect the last option.

so along comes the political compass, which explains itself:

The old one-dimensional categories of 'right' and 'left' , established for the seating arrangement of the French National Assembly of 1789, are overly simplistic for today's complex political landscape.

i took the test and ended up a lefty libertarian, which wasn't surprising. what was surprising to me was the the political compass itself, specifically it's use of "libertarian" and "authoritarian" as a second axis. i was immediately reminded of seeing a strikingly similar political compass at libertarian.org. this site is currently in transition, and seems slightly less influenced by the libertarian party than it was back when i first saw that compass, but as the site points out, it was originally developed by chris whitten, a libertarian himself.

while putting "libertarian" at the opposite end of the spectrum as "authoritatian" is something libertarians like to do, i think it's ridiculous. "authoritarian" is not the opposite of "libertarian". dictionary.com defines "authoritarian" in part as against individual freedom. the problem is that "libertarian" means both advocates maximizing individual rights and minimizing the role of the state (as dictionary.com recognizes) and "member of the libertarian party". were the word not capitalized at the political compass, the compass may not so strongly imply that anyone not a member of that party is against individual freedom (which is not the same thing as individual rights - another way in which the labeling is inappropriate), but it is capitalized.

we see this problem with the word "democrat", which dictionary.com properly defines as both An advocate of democracy and A member of the Democratic Party. we commonly show the difference by capitalizing when referring to the party. but imagine if the political compass had "Democrat" at one end and "Authoritarian" at the other. authoritarians are, after all, against democracy, so this would be reasonable were there not an established political party with that name. but as there is a democratic party, this compass would imply that all republicans are authoritarians, which, current administration aside, is an unfair characterization. that's my problem with using "libertarian" and "authoritarian" as opposite ends of an axis.

i think there's a real need for something to move us beyond thinking of politics in terms of "left" and "right", but i don't think the political compass is a solution. rather than adding another axis, i think we need to get rid of the axes altogether. a new axis just doubles the number of ways in which you can be "with us or against us". i'd like to think my agreement with "conservative" jonathon or my support of a presidential candidate the political compass has placed in the completely opposite end as myself are indications that you can be with us and against us.

 

brad sucks writes:

I find this whole iTunes universe totally bizarre and unnatural. To me it seems too much like the old decidedly F'd up model dressed up to look like something new. Maybe it'll stick, but right now it just feels like a step backwards to me and that technology + progress is going to lay the smack down on it any day now.

it's not as clear to me that "the smack" will be laid down any day soon. i'm afraid all those arguments from filesharing proponents about how musicians don't get a fair shake with the current music distribution system were just empty rhetoric. now that cheap and legal music distribution systems exist, few users seem to care whether or not they're fair. the debate has shifted to which unfair system is the best, which is really just a question of user interface. the money in all of these systems is going to the same people - not the musicians, but the distributors. only now the distributors aren't even doing the distributing. it's not even "the old decidedly F'd up model" as brad puts it; it's worse.

 

if you search for "hhhhhhhhhhhhhhhhhhhhhhhhhh", google will ask you if you didn't intend to search for "hhhhhhhhhhhhhhhhhhhhhhhhh" (via language hat, from cinderella bloggerfeller). this raises the question of what makes google think 26 h's should be 25 h's. certainly that sort of spelling correction isn't entered by a human, but it can't be just pure numbers either, or ostitch, with only 22 results, would have a spelling suggestion, and disemployed with over 1,500 results, would not. further testing of the letter "h" shows that it's not only 26 h's that returns a spelling suggestion. according to google, 4 h's should be 3, 7 h's should be 8 (as should 9), 12 h's should be 11, and so on, up to 128 h's, which is google's maximum allowed word length. clearly google has some minor tweeking to do. i, for one, will not be satisfied until i can search for 129 h's and have my spelling properly corrected to 128 h's.

 

jonathon delacour writes I also enjoy talking about interesting things with not just “one or two” but up to three people! last night i attended a meeting with three other people. the meeting went well. the night before, i attended a meeting with six or seven other people. that meeting also went well, but looking back, it occurs to me that it may not have gone so well (from my perspective) had we sat at a round table. as it was conversation generally polarized toward the ends of the long table, in groups of three or four. last week i attended a meeting with about twenty other people, but we split into groups of two or three for a large part of the meeting.

this last meeting was for the bloomington-normal citizens for peace and justice, a local community organization i've been involved in to varying degrees, depending on my geographic distance, since it was founded shortly after september 11, 2001. now that i'm back in bloomington-normal, i'm much more actively involved than i was from taiwan or michigan. and i've resumed pushing for more small group time. this pushing played some part in the small group time we had at the last meeting.

prior to today, i would have said that my reason for pushing for small groups is something i read a long time ago in a book about the practice of organization. the book said something like "meet in groups of six or less", and i've since been encouraging organizations i'm involved in to do just that. but it occurs to me now that my interest in that advice and my remembering it for years after are likely strongly tied to being an introvert. were i an extrovert, i might well have read that same passage and discarded the advice in an instant, finding large groups much more conducive to getting work done.

i still think the advice sound, however, even after realizing my own bias toward accepting it. my reasoning now is that any organization is likely to have introverts as members, and i suspect (though i'm not at all sure) whatever discomfort an extrovert may feel in participating in a small group is significantly less than that an introvert feels in participating in a large group. for the groups i'm involved in, participation is vital. elizabeth lawley has done some intial explaining of extrovert perspective, but i still have a question for any extroverts out there: do extroverts feel uncomfortable participating in small groups? maybe "uncomfortable" is the wrong word even. when i'm in a large group setting, i don't usually feel "uncomfortable" participating. i more often feel unable to participate, because the pace of conversation is faster than my ability to solidify my thoughts. do extroverts have a similar (or opposite) sensation in small groups?

 
small packages good things considered is whether the stock will it catch up by armando beauty network offers if it's real november still life with woodpecker compare new and used car prices auto insurance quotes car rental deals worldwide car rental and van hire services hampshire county council site offers syndication feeds and why hypnosis works so well his electoral highness at the plenary vote help go back to the set of modules required sean chittenden org programming columns and essays on canadian writing on the web us department of justice has been done by barenaked ladies view the most wanted paintings by leslie veen purpose driven life by rick klau november dinner in zanzibar the moon and back quality is gespecialiseerd in een nieuw jasje door onze nieuwe economie twee jaar voor afpersing prostituee dordrecht confession of faith copyright revival in the family violence prevention the centers for disease control and dynamical systems and technology click on the library of congress about news com au vodka game product id not accepted obsolete oldnat optimizations pending submitted userspace ipv patches erycius puteanus registratienummer aantal landelijk regionaal labyrint in perspectief bezoekadres meerkoethof postadres radio centraal frequenties donateur te worden bent u grondplan ub com du it com free industry research briefs selected annotated bibliography compiled to help those in certain professions a consultative group ivacg held its organizational meeting january stennis space center houston read the bill of rights and you teaching effectiveness this web site included in library databases by name internet domain names with netregistry invariably includes significant lab work as diversity dissolves nashville truck practice nascar media night september in the suburbs by william shakespeare ed by stephen what kind of thinker are you every year the team contact home moms network local exchange events the trouble begins books the spider and fly swap roles predator and prey in web programming features epsilon has no homology attgacc gttgacg tttgaca tttgaca aaat aaacctataaaaa cttgtttt tatag gtttgactggatgcctgcctacgcgggaatgacat gtgtcattcccgcgtaggtggtaatcc ag aaaaa hongkong and yaumati ferry company services first listing in reply to sean posted by cert april anderson henry able seaman the american cancer society we are church imwac internationale bewegung zur verteidigung der menschenrechte resolution a resounding success for rakewood email this page site of the interior initiatives to address eu charges by ina garten you travel through space european strategy for the library index libdex is nearing collapse by sunday nov monday nov update by basin home health inc is an academic paper hosted by displaying headline to ipfilter this from george civil engineer proposed won a bet barbara has to pay the rent and feed the children acquires one million songs in the classroom members only registration welcome to the world contain selective links to magazine serves a certain purpose are placed the us government's official one stop access to recreation pool is a lousy defense wired hope lianne mclarty e mail is more reliable image host posted friday april editorial cartoon fred curatolo cnews poll dna samples micro array software identifies and then there was a young person's guide to dying girl updated illustrated by previously published articles reviews tutorials tools tips staff developer howard shieferdecker realvest partners about hiv and aids tutorial developed by the department of homeland security is for managers of student engagement lssse we are church imwac and the chamber of commerce is coming modestly eventually buying carpet online have a dream speech to lou marinoff's web site once payment is it just makes sense web ring foursquare gospel fort wayne indiana contains square miles and a lifetime of color presents challenge for free roulette game online inside games part iv in the newsroom center stage at international meeting on bayesian data analysis briefbook the data analysis provides tools for financial planning is easy with autocomplete textboxes by nicholas gordon has a seat web site you agree with the children's online privacy protection rule kidz privacy website design competition announcing the new model of education about us profile canwest global communications inc all rights reserved redistribution for kids kids corner fun with math anxiety has increased substantially under bush soros by jackie mason raoul felder a chat server by step article discusses how the scientific up introduction of learning is an el ni o loss says net usage passes java infoworld sep sun clague a alias alices clague un org public english new testament with an english dictionary by soccer coach by golden books author search help basics of usenet find faqs and tutorials java an introduction to some arguments against war by sun tzu on the web us higher education funding council to oversee most us firms paid no income taxes in oregon the nature conservancy has protected the adult aids clinical trials unit in london houses one home with little or too much fruit juice recipes many from alice with charlie wisteria pfisteria hysteria which functioned as a water cycle wheel tie downs truck boxes storage sheds shed plans and building a greenhouse adapted from single use camera with linux introduction for hams power that's appropriate for a vbac my way see more product details what is icq icq oscar protocol and icq messages the message counter date jul title the supreme court opinions selected case summaries civil procedure rules what's new what is really happening not only through tattoos by studio page music quick links bio top analysis motivation lepton identification heavy duty brass pushbutton amp meter main with provision authored by john jay retired to a cloud is the sun what files need clicked to show hi lites monte carlo's lightest offereing is perfect for the home office is getting friendlier or at anfahrtsplan sk free host stats the facts about trademarks trademark and service oriented architectures by fiorano software inc cerious and jasc products are windows and linux providing information to wmi provider rating page provides links to web gopher to forest triathlon and endurance duathlon saturday june in washington dc webmaster community social capital and steam power in the future this week david green reported that the foreground and background colors how to search the web for sound effects on the web us department of homeland security information resource pir in afghanistan as kabul appeals to so called junk by thor china china travel service has sustained the loss of her peers by election lord randolph informed the council for exceptional children is there hope for the american way cruise vacations from the past days archive january on this day by day the cover directed by peter miller this is a process that cannot be displayed or can't browse original message if you can cast your worries at liard hot springs resort is game on sweden info information urlaub herzlich willkommen gute reise bing bong be caneuon gwerin ac emynau can central is intended or not by chance shattering the modern history sourcebook login to the terms that define the limitations of linux joseph pranevich the wonderful world of the vikings where did we go from here to eternity memorable moments the most accurate name address and phone numbers a back end generator beg a back end default branch section unix support produces a wide range of reason jacques will write direct astro boy tartakovsky substituir eric patrick agora de emerson click here for information display sid february vol cover photo to make their own words is an educational mailing list is a rainbow author thomas pynchon a sixties scrapbook the lyres i want to buy this book with over songs in a nutshell may be spoilers the script shack index to compaq if you are feeling photo ericka pizzillo the bellingham herald the olympian olympia washington day archive search florida federal jobs since over years independent journalist agencia de prensa anteriores buscador de noticias rcn busquedas domingo de la calzada logro o org cliquez ici contactez nous audiovisuel commerces cybercaf model for information literacy and media directory news search the web shopping about to get fired because of bugs some edmonton computers electronics shopping page spread the icons of desktop manager were the first lady biographies presented here november early december architecture student jane warren meeks december kendall topham currently has the gall to operate across the atlantic slave trade much trail riding experience welcome to the future and addresses the two micron all sky survey a project of stay october am opening ceremony when am i going to be a good science fair projects link firefighting technology discovery science nids is an extremely goofy movie a cast of corbies and you'll be ok with trade businesses find russia an unfinished job is very important home equity loan rates and policies returns and warranties implied into the contract specification shall be sound asleep a few minutes later iraqi ambassador to iraq zalmay khalilzad has just been released click here very soon hic tipu's bengaluru we will also perform controller duties will include microsoft's palladium security initiative csi is an exception to the salvation army's hurricane relief and recovery act rcra involves solid phase extraction spe microplates activated microplate wells titertek were coated with pfa fep lining for glass harmonica music publishing inc all right reserved disclaimer partially developed by afkar media damascus university syria grad yr e mail address tags which direct and indirect costs direct and indirect costs direct indirect overheads ofcom intends to publish nasm photographs for use of csiro bred kuruma prawns was significantly reduced their severity impacts and adaptation agronomic and economic development dbed under cooperative agreement cadc cbfma and po this update translates into huge vats of urine dangerdoom min of meer gedis cussieerd met het zogenaamde burlen van de herten in het de jaar en reserveringsruimte geldt vanaf januari aanstaande het debat serieus toon maar doe het wel een miskraam had gehad voelde ik me verbonden met deze statistieken laatste wijziging augustus stoma artikelen kunt u ofwel telefonisch aanvragen ofwel projectvoorstellen werden ingediend om vrijgesteld te worden van het kamerburo vervolgens je werk of een grondwerk wegenbouwkundig werk bouwwerk grondwerk wegenbouwkundig of waterbouwkundig werk een dertig jaar jongere broer freek uitgenodigd zoenvis knuffelbeer door harmen lustig en steven pienaar voorspoedig dan verwacht in voorbije jaren waardoor het economisch en sociaal comit eesc this text refers to the labrador retriever encompassing agility conformation obedience earthdog and agility drills wednesdays in carpet cleaning restoration certification iicrc formally iicuc next class next class next class next class or i done to date by clicking here store ratings bizrate gleans its ratings the concord and merrimack rivers penguin classics a contemporary tweak dishes are served nightly by candlelight to intimate partner violence ipv victimizations reported in secunia advisory often cover medical recompression facility prepared with albert einstein arguably the greatest jeneration report shiites uprising that followed the kurdish peshmerga fighter from the choices below about etcp middot candidate l lection stary awake the band wagon is equipped with ohmic contacts to gan eden elyon tzemach atlas middot hagahot u teshuvot responsa tzitz eliezer contemporary rabbinic responsa bilidad antr ant aok gesundheitskasse streetballtour sachsen anhalt middot schleswig holstein middot submit genealogy data middot mortgage loans and refinancing visit allied health education promoting educational information and preservation of your home's resale value added resource center a s all rights reserved terms of franz reinelt zinsh usler contemporary munich webcams middot videos sms middot infobel annuaire telephonique retrouvez nom breux sur avre phone ou fax afin que claranet puisse sous traiter quelle securite en europe su de favoritos haga clic en el bot edici bus this text your browser edb nobody aa expo light compila i seguenti fantasport fantacalcio fantatennis fantasci fantaciclismo fantaformula fantamoto fantarugby fantasci combattimento this text it means your browser for instructions on using ezimerchant professional ecommerce shopping cart middot golf ball finders lower picture at gallery honours cecil beaton owner photograph used with permission more fine grained sediments white et al plone and its visual design is only visible when printed sheet fed sidewall small orifice sprinkler heads o ye gates and be
 

i'm collecting the daily outputs of the prose page. so far, according to a handy online word counter, i have 2,062 of the 50,000 words i need to constitute a novel before the end of the month, putting me terribly behind schedule. but that's okay.

the prose page is entirely driven by google results. when i wanted to know how many words i would need to produce in a day to reach 50,000 in a month, i used google to do math for me. and when i wanted to get a word count, i again used google to find a page that would do that for me. there was a time when i would have launched applications to handle all of those tasks, but now i do them all in my browser, and i don't see any indication that this trend will change any time soon. increasingly, the web is my operating system, and google is my finder.

 

i have a theological question for anyone out there so inclined: why were a people who weren't allowed to use god's name told not to use it in vain?